View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_high_45 (Length: 290)
Name: NF5999_high_45
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 3883950 - 3884214
Alignment:
| Q |
17 |
aatcagtgtgcatgaacttatttgaatcaacattcgatctgccagtctcaaacctacaccatcaaaccaacccttgcgggttagatttttccaaacttgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3883950 |
aatcagtgtgcatgaacttatttgaatcaacattcgatctgccagtctcaaacctacaccatcaaaccaacccttgcgggttagatttttccaaacttgt |
3884049 |
T |
 |
| Q |
117 |
tgatttgccataaagtgtgcatgaatttattgattttccaaacctacactatcaattatatcttgattttaagaggatgcattggattatacaaggagtc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3884050 |
tgatttgccataaagtgtgcatgaatttattgattttccaaacctacactatcaattatatcttgattttaagtggacgcattggattatacaaggagtc |
3884149 |
T |
 |
| Q |
217 |
tctaggttaaaaataagatatatctctcatcttttagccaaatttggttctttttgcagtataat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884150 |
tctaggttaaaaataagatatatctctcatcttttagccaaatttggttctttttgcagtataat |
3884214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 246 - 277
Target Start/End: Original strand, 3872836 - 3872867
Alignment:
| Q |
246 |
tcttttagccaaatttggttctttttgcagta |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3872836 |
tcttttagccaaatttggttctttttgcagta |
3872867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University