View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_high_50 (Length: 270)
Name: NF5999_high_50
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_high_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 35448543 - 35448784
Alignment:
| Q |
11 |
cacagaaacacaagagagaggacataccagaaaacagagaaacaagatccggaaagctagaacaaatgtttagaaaatccataactgcttcattgtcaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35448543 |
cacagaaacacaagagagaggacataccagaaaacagagaaacaagatccggaaagctagaacaagtgtttagaaaatccataactgcttcattgtcaga |
35448642 |
T |
|
| Q |
111 |
atctgagttggactcgacaccagagattggcatagctgaagcatcgcggacatttgagccggtctccacggcatttctatcagcaccagacatgtgagga |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35448643 |
atctgagttggactcgataccagagattggcatagctgaagcatcgcggacatttgagccggtctccacggcatttctatcagcaccagacatgtgagga |
35448742 |
T |
|
| Q |
211 |
aaacttgaatattcaggttgtactatggccatctgcccatta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35448743 |
aaacttgaatattcaggttgtactatggccatctgcccatta |
35448784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University