View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_high_51 (Length: 269)
Name: NF5999_high_51
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_high_51 |
 |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 52231136 - 52230884
Alignment:
| Q |
1 |
attcagccactgtccagactcaacagtagaagtatcagactcatcacattcaggaatagtaggtggagtataaaggttccggtgggatggactagtaggc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52231136 |
attcaaccactgtccagactcaacagtagaagtatcagactcatcacattcaggaatagtaggtggagtataaaggttccggtgggatggactagtaggc |
52231037 |
T |
 |
| Q |
101 |
gcagaagctgcaaagaaagggtgattgaaggatgtccctgatgctttggcaattgattcccatgttggaatcatgggtttaggatttcttgaggttggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52231036 |
gcagaagctgcaaagaaagggtgattgaaggatgtccctgatgctttggcaattgattcccatgttggaatcatgggtttaggatttcttgaggttggtg |
52230937 |
T |
 |
| Q |
201 |
atgagacaggtggagtcacgggcgcgctgtttgatattctcaaaggtgggaga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52230936 |
atgagacaggtggagtcacgggcgcgctgtttgatattctcaaaggtgggaga |
52230884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 15436341 - 15436289
Alignment:
| Q |
161 |
catgttggaatcatgggtttaggatttcttgaggttggtgatgagacaggtgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
15436341 |
catgttggaatcatgggtttaggatttcttgaggtgggtgatgaaataggtgg |
15436289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 25850 - 25902
Alignment:
| Q |
161 |
catgttggaatcatgggtttaggatttcttgaggttggtgatgagacaggtgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
25850 |
catgttggaatcatgggtttaggatttcttgaggtgggtgatgaaataggtgg |
25902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University