View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_high_53 (Length: 258)
Name: NF5999_high_53
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_high_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 239
Target Start/End: Original strand, 6803177 - 6803406
Alignment:
| Q |
10 |
attattctcctcccacttttgccgaatgttaacacatatttgttgcgcattaagtttacataaacttttatcatattttaaatcgttgtccgtttaaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6803177 |
attattctcctcccacttttgccgaacgttaacacatatttgttgcgcattaagtttacataaacttttatcattttttaaatcgttgtccgtttaaaaa |
6803276 |
T |
|
| Q |
110 |
cttgatgtagtgctaagtaatattgtatcattcnnnnnnnncaagactaaataatatcgtatcagtggtgtctgttttggtattagtagttaatggttgt |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6803277 |
cttgatgtaatgctaagtaatattgtatcattcttttttttcaagactaaataatatcgtatcagtggtgtctgttttggtattggtagttaatggttgt |
6803376 |
T |
|
| Q |
210 |
ttcattaagattagagattagacactagac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6803377 |
ttcattaagattagagattagacactagac |
6803406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University