View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_31 (Length: 334)
Name: NF5999_low_31
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 227 - 313
Target Start/End: Complemental strand, 4737282 - 4737196
Alignment:
| Q |
227 |
caattagtcccctttattgcccagttgttttgaaagcatgtggacagtcaaaagtcccaacatagaattcaagatgaaatttaatta |
313 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4737282 |
caattagtcccctttattgcccatttgttttgaaagcatgtggacagtgaaaagtcccaacatagaattcaagatgaaatttaatta |
4737196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 81 - 139
Target Start/End: Original strand, 2806529 - 2806587
Alignment:
| Q |
81 |
ctgtataccctattaattaggtgtgaccaacaaattctaccaagtaaataggccacgat |
139 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2806529 |
ctgtatagcatattaattaggtgtgaccaacaaactctaccaagtaaataggccacgat |
2806587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 172
Target Start/End: Original strand, 2806607 - 2806639
Alignment:
| Q |
140 |
gctaaataacttggtcaaaagaaaacggtttag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2806607 |
gctaaataacttggtcaaaagaaaacggtttag |
2806639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 172
Target Start/End: Original strand, 34154339 - 34154371
Alignment:
| Q |
140 |
gctaaataacttggtcaaaagaaaacggtttag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34154339 |
gctaaataacttggtcaaaagaaaacggtttag |
34154371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 95
Target Start/End: Original strand, 34154297 - 34154331
Alignment:
| Q |
61 |
aatataataacgttgcaaaactgtataccctatta |
95 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
34154297 |
aatataataacgttgcaaaactgtatgccctatta |
34154331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University