View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5999_low_38 (Length: 298)

Name: NF5999_low_38
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5999_low_38
NF5999_low_38
[»] chr4 (1 HSPs)
chr4 (1-280)||(32902840-32903119)


Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 32903119 - 32902840
Alignment:
1 ttttagaggaacaaatggttatacataataattgcatatgatcaaaataactcccaatcaaatattgattgtgaaagaatttaattaggggaagcatgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32903119 ttttagaggaacaaatggttatacataataattgcatatgatcaaaataactcccaatcaaatattgattgtgaaagaatttaattaggggaagcatgca 32903020  T
101 tattgattttgaaaagaatctctcatgggtaaagatgatttctatttgagctgtgtttgaattagtctctaatttgaacctagatgttgagcaacttgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32903019 tattgattttgaaaagaatctctcatgggtaaagatgatttctatttgagctgtgtttgaattagtctctaatttgaacctagatgttgagcaacttgaa 32902920  T
201 gcgaagacgacgttcttttatgatagtttggaggaagagatctatagtcttgaagataatcatattatcaactctcctaa 280  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
32902919 gcgaagacgacgttcttttatgatagtttgggggaagagatctatagtcttgaagataatcatattatcaactctcctaa 32902840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University