View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_39 (Length: 296)
Name: NF5999_low_39
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 121 - 283
Target Start/End: Original strand, 32903519 - 32903681
Alignment:
| Q |
121 |
ggctattaagctaaggtgaataagagagtcaaacaaaaataacctaaactaggtatgaaacttaattctctgggttagggtgatccttcatactatatct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32903519 |
ggctattaagctaaggtgaataagagagtcaaacaaaaataacctaaactaggtatgaaacttaattctcagggttagggtgatccttcatactatatct |
32903618 |
T |
|
| Q |
221 |
tgggttattatgtattctttgccattgnnnnnnntaattacgtaaagttaaactgaagaagaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32903619 |
tgggttattatgtattctttgccattgaaaaaaataattacgtaaagttaaactgaagaagaa |
32903681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 32903294 - 32903347
Alignment:
| Q |
1 |
ttttatatatcaaacgttcaacccgtcgatgagactaccattcacatttgaatt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32903294 |
ttttatatatcaaacgttcaacccgtcgatgagactaccattcacatttgaatt |
32903347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University