View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_41 (Length: 295)
Name: NF5999_low_41
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 6108084 - 6107824
Alignment:
| Q |
16 |
gcaaaggctgtaagatcgtgcgttgatgtaatggaggaaggaatagtgaaaattgaatctgatgtttgggcatgtgatgatgatggtgatgttcagacaa |
115 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6108084 |
gcaaaggctgtaaggttgtgcattgatgtaatggaggaaggaatagtgaaaactgaatctgatgtttgggcatgtgatgatgatggtgatgttcagacaa |
6107985 |
T |
|
| Q |
116 |
tccataacatggatgatgaggttggtggagatgatgatatttccattttaacactcaagcaaattaaagaggtctgcaaagcaaggaagagaaaacgctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
6107984 |
tccataacatggatgatgaggttggtggagatgatgatatttccattttaacactcaagcaaattaaagatgtctgcaaaacaaggaagagaaaacgctc |
6107885 |
T |
|
| Q |
216 |
acaaggtctcgactctttgaacataaaaataaaaattgatgatccatcatccccggaagac |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6107884 |
acaaggtctcgactctttgaacataaaaataaaaattgatgatccatcatccccggaagac |
6107824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University