View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_43 (Length: 293)
Name: NF5999_low_43
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 56 - 275
Target Start/End: Complemental strand, 38509852 - 38509631
Alignment:
| Q |
56 |
agaaccataagttgtatacatttgaaatagttgtannnnnnnncagctgtttggatgcagtatata--cttaatgtttctttttacctttctatcctcgt |
153 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38509852 |
agaaccataagttctatacatttgaaatagttgtattttttttcagctgttcggatgcagtatatatacttaatgtttctttttacctttctatcctcgt |
38509753 |
T |
|
| Q |
154 |
tgtaaaaatagtctaacatttcatctaacagatgctttcagtgcttcttgccacagttggagcagctatgtcattgataaaatttgagaattcatttgac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38509752 |
tgtaaaaatagtctaacatttcatctaacagatgctttcagtgcttcttgccacagttggagcagctatgtcattgataaaatttgagaattcatttgac |
38509653 |
T |
|
| Q |
254 |
aataaccatcaaagattaggtt |
275 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38509652 |
aataaccatcaaagattaggtt |
38509631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University