View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_74 (Length: 213)
Name: NF5999_low_74
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_74 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 10 - 112
Target Start/End: Complemental strand, 11591793 - 11591691
Alignment:
| Q |
10 |
agattatactacatataacttctatacatttcaggaacttactaaagtataatcaaaacccaaaacccatttccattatccatcagttcaaccatctggg |
109 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11591793 |
agattatactacatataacttctatacttttcaggaacttactaaagtataatcaaaacccaaaacccatttccattatccatcatttcaaccatctggg |
11591694 |
T |
 |
| Q |
110 |
cca |
112 |
Q |
| |
|
||| |
|
|
| T |
11591693 |
cca |
11591691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University