View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_77 (Length: 210)
Name: NF5999_low_77
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 34485604 - 34485785
Alignment:
| Q |
12 |
ataatactcatctttcaatattaaccaaaatgggactaagtaaaaatatccaaacacatgaatcatatcattgattccaaatcaaaccatatttaaatat |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34485604 |
ataacactcatctttcaatattaaccaaaatgggactaagtaaaaatatccaaacacatgaatcatatcattgattccaaatcaaaccatatttaaatat |
34485703 |
T |
|
| Q |
112 |
taaccaaatgtaaggcatctacatataaactaaaacccttgattgaaaatgaacaaaaattgtcaaaatacatacatgatac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34485704 |
taaccaaatgtaaggcatctacatataaactaaaacccttgattgaaaatgaacaaaaattgtcaaaatacatacatgatac |
34485785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University