View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5999_low_78 (Length: 203)
Name: NF5999_low_78
Description: NF5999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5999_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 49 - 186
Target Start/End: Original strand, 28485004 - 28485143
Alignment:
| Q |
49 |
cttcttaactcgacccactctccgttttattactaannnnnnncgagggttcttcacatcactct--ctggttcttcaattgatagttttccactcagta |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28485004 |
cttcttaactcgacacactctccgttttattactaatttttttcgagggttcttcacatcactctctctggttcttcaattgatagttttccactcagta |
28485103 |
T |
 |
| Q |
147 |
gaatggaagagattaaccagaaggaggaggaagatcatcc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28485104 |
gaatggaagagattaaccagaaggaggaggaggatcatcc |
28485143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 119 - 186
Target Start/End: Original strand, 28466673 - 28466740
Alignment:
| Q |
119 |
tcttcaattgatagttttccactcagtagaatggaagagattaaccagaaggaggaggaagatcatcc |
186 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28466673 |
tcttcaatttatagttttccactcagtagaatggaagagattaaccagaaggaggaggaatatcatcc |
28466740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 30684364 - 30684404
Alignment:
| Q |
146 |
agaatggaagagattaaccagaaggaggaggaagatcatcc |
186 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
30684364 |
agaatggaagtgattaaccaaaaggaggatgaagatcatcc |
30684404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University