View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6000_high_13 (Length: 262)
Name: NF6000_high_13
Description: NF6000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6000_high_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 2490776 - 2490530
Alignment:
| Q |
16 |
atctttagagaaattgccaagttacctaatccttttgtatctcttgctgaattagctctctaacaggtctataagcagcggttgtgcataagttctgcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490776 |
atctttagagaaattgccaagttaccgaatccttttgtatctcttgctgaattagctctctaacaggtctataagcagcggttgtgcataagttctgcat |
2490677 |
T |
|
| Q |
116 |
ttaacaattaatgaaaatggaaaatgcattaagacatcagaaactaaacataagaaaagcatttgtagattgtaacacgatagttaagttacggccatag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490676 |
ttaacaattaatgaaaatggaaaatgcattaagacatcagaaactaaacataagaaaagcatttgtagattgtaacacgatagttaagttacggccatag |
2490577 |
T |
|
| Q |
216 |
gaaaacaataatagagaaaaaccttcagatcacttccactatatcct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490576 |
gaaaacaataatagagaaaaaccttcagatcacttccactatatcct |
2490530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 55 - 116
Target Start/End: Original strand, 41589433 - 41589494
Alignment:
| Q |
55 |
tctcttgctgaattagctctctaacaggtctataagcagcggttgtgcataagttctgcatt |
116 |
Q |
| |
|
||||||||||||| | ||||||||| || | ||||||||| |||||||| |||||||||||| |
|
|
| T |
41589433 |
tctcttgctgaatcaactctctaactggccgataagcagcagttgtgcacaagttctgcatt |
41589494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University