View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6000_high_14 (Length: 253)
Name: NF6000_high_14
Description: NF6000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6000_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 17124825 - 17124927
Alignment:
| Q |
1 |
ggtatgcaggggatttcctgtttggctaaagtatgtaccaggtgttgctttcagaacagacaatgagccgttcaaggttggtgtt-ttttctgtttggtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17124825 |
ggtatgcaggggatttcctgtttggctaaagtatgtaccaggtgttgctttcagaacagacaatgagccgttcaaggttggtgttattttctgtttggtg |
17124924 |
T |
|
| Q |
100 |
ctt |
102 |
Q |
| |
|
||| |
|
|
| T |
17124925 |
ctt |
17124927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 166 - 244
Target Start/End: Original strand, 17124991 - 17125069
Alignment:
| Q |
166 |
ctaacaaccgtcctaattattgtcatgatgtatgttaggcggctatgcaaaaattcactaccaagattgtcagtattat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17124991 |
ctaacaaccgtcctaattattgtcatgatgtatgttaggcggctatgcaaaaattcactaccaagattgtcagtattat |
17125069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 86
Target Start/End: Original strand, 5229913 - 5229994
Alignment:
| Q |
5 |
tgcaggggatttcctgtttggctaaagtatgtaccaggtgttgctttcagaacagacaatgagccgttcaaggttggtgttt |
86 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| || || | ||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
5229913 |
tgcagaggatttcctgtttggctcaagtatgttcctgggatggctttcagaacagacaatgagccatttaaggttggagttt |
5229994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 81
Target Start/End: Complemental strand, 52550405 - 52550327
Alignment:
| Q |
3 |
tatgcaggggatttcctgtttggctaaagtatgtaccaggtgttgctttcagaacagacaatgagccgttcaaggttgg |
81 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||| || || |||| |||||||||||||| |||| || |||||||| |
|
|
| T |
52550405 |
tatgcagtggatttccagtttggctcaagtatgttccgggcattgcattcagaacagacaaccagccttttaaggttgg |
52550327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University