View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6000_low_15 (Length: 251)
Name: NF6000_low_15
Description: NF6000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6000_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 54238352 - 54238564
Alignment:
| Q |
14 |
cagagacctaaagaaaaacacacattttcgaggtcacaaacctacgccactaaactaaccatgggtttttaaataaaaacgcatttgattaacnnnnnnn |
113 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
54238352 |
cagagatctaaagaaaaacacacattt-cgagatcacaaacctacgccactaaactaaccatgggtttttaaataaaaatgcatttaattaacttttttt |
54238450 |
T |
 |
| Q |
114 |
n-cacaaatgcaagattcttggagaaaattgagtttgaagggaaggaaggaaataataggaaggttggttttgatgaagaacataatattactggagaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
54238451 |
ttcacaaatgcaagattcttggagaaaattgagtttgaagggaa----ggaaataataggaaggttggatttgatgaagaacataatattactggtgaga |
54238546 |
T |
 |
| Q |
213 |
aagttttcgtgcctgtaa |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
54238547 |
aagttttcgtgcctgtaa |
54238564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University