View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6000_low_17 (Length: 237)
Name: NF6000_low_17
Description: NF6000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6000_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 17 - 88
Target Start/End: Original strand, 12598476 - 12598547
Alignment:
| Q |
17 |
atcaaaattcaaaaaggtaaatatgtttaagaaataacagctcggtataagatgaagattaggaagctaatt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12598476 |
atcaaaattcaaaaaggtaaatatgtttaagaaataacagctcggtataagatgaagattaggaagctaatt |
12598547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 12598622 - 12598673
Alignment:
| Q |
163 |
gcactgatataagtatcaaaaatacttcatttcacttctatatcacaagtct |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12598622 |
gcactgatataagtataaaaaatacttcatttcacttctatatcacaagtct |
12598673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 3376603 - 3376545
Alignment:
| Q |
17 |
atcaaaattcaaaaaggtaaatatgtttaagaaataacagctcggtataagatgaagat |
75 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
3376603 |
atcaaaattctaaaaggtaaatatgtttaacaaataacagctcggtataagataaagat |
3376545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University