View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6000_low_19 (Length: 209)
Name: NF6000_low_19
Description: NF6000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6000_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 2608408 - 2608217
Alignment:
| Q |
1 |
cttggaattcaatgaacctgcatttgatgaatatgatccaacaccttatggtggtggatatgacattgattcaacctatggtaagcctcttgcaccttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2608408 |
cttggaattcaatgaacctgcatttgatgaatatgatccaacaccttatggtggtggatatgacattgattcaacctatggtaagcctcttgcaccttca |
2608309 |
T |
|
| Q |
101 |
gataaaatttgctatcctcgttctggttctggttcaattccaactccaattccaattccaattc------caatacctcttcctgtggaaga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||| ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2608308 |
gataaaatttgctatcctcgttctggttcaattccaactccaattccaattccaattccaattccaattccaatacctcttcctgtggaaga |
2608217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University