View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6000_low_5 (Length: 473)
Name: NF6000_low_5
Description: NF6000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6000_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 108 - 376
Target Start/End: Original strand, 47949087 - 47949368
Alignment:
| Q |
108 |
tattgttgaagggagttggtctaaatatactattctttttgaactttttaagattgcttatctgagctttggtccct------attactacttggtgata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
47949087 |
tattgttgaagggagttggtctaaatatactattctttttgaaatttttaagattgcttatctgagctgtggtccctctacttattactacttggtgata |
47949186 |
T |
 |
| Q |
202 |
gcacaaaatgcgggatcatgtgggttgtcactatcttctgggggaaaattgagaacacatggtagttattatttatcaaggaaaaggaaaatgccctcgt |
301 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47949187 |
gcacaaaatgcggggtcatgtgggttgtcattatcttctgggggaaaattgagaacacatggtag---ttatttatcaaggaaaaggaaaatgccctcgt |
47949283 |
T |
 |
| Q |
302 |
tgttgatatgcaggttttggtccagc----------tatataggaaaatttcagagctgactgctggaggcatgaattaataaat |
376 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47949284 |
tgttggtatgcaggttttggtccagctatatatctatatataggaaaatttcagagctgactgctggaggtatgaattaataaat |
47949368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 47948840 - 47948939
Alignment:
| Q |
11 |
cagagaacattattggtgtgaatgtgaatatgtgattaaactaaactccagttgccgttatagtttttt-ctgacagaaattgtttttgagaattttata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47948840 |
cagagaacattattggtgtgaatgtgaatatgtgattaaactaaactccagttgccgttatagttttttcctgaaagaaattgtttttgagaattttata |
47948939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 423 - 458
Target Start/End: Original strand, 47949405 - 47949440
Alignment:
| Q |
423 |
aaatcagggaaaataaaataaaagacatatgttggt |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47949405 |
aaatcagggaaaataaaataaaagacatatgttggt |
47949440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University