View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6001_low_2 (Length: 252)
Name: NF6001_low_2
Description: NF6001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6001_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 104 - 212
Target Start/End: Complemental strand, 3302663 - 3302555
Alignment:
| Q |
104 |
attaacaactcttactagataatgagtttttctattcataggcttataggctttaagccaccaacaatgttttccctttattgataataatgtactaata |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302663 |
attaacaactcttactagataatgagtttttctattcataggcttataggctttaagccaccaacaatgttttccctttattgataataatgtactaata |
3302564 |
T |
 |
| Q |
204 |
atcaccata |
212 |
Q |
| |
|
||||||||| |
|
|
| T |
3302563 |
atcaccata |
3302555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 11 - 109
Target Start/End: Complemental strand, 3302791 - 3302693
Alignment:
| Q |
11 |
agaaaataaaagacattaaatacaatcaaatgtgttgacactgacacactttcaatatgatgtgtcggtgtttcatagaatataactattgtaattaac |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3302791 |
agaaattaaaagacattaaatacaatcaaatgtgttgacaccgacacactttcaatatgatgtgtcggtgtttcatagaatataactattgtaattaac |
3302693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University