View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6002_high_10 (Length: 239)

Name: NF6002_high_10
Description: NF6002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6002_high_10
NF6002_high_10
[»] chr7 (1 HSPs)
chr7 (18-194)||(43985260-43985433)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 43985260 - 43985433
Alignment:
18 gactactcaaagccccatccttctcgcatatcatagaccttcgaatactaaccctcttaaagtttagccatgcacacacaatacttaccaatatcttaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||    
43985260 gactactcaaagccccatccttctcgcatatcatagaccttcgaatactaaccctcttaaagtttagccatg----cacaatacttaccaatatcttaaa 43985355  T
118 taaaatcactcaatca-nnnnnnnaataagattcgtctatattcagtttaactcacccttttaaaagaggttgaacca 194  Q
    ||||||||| ||||||        || |||||||||||||||||||||||||||||||||||||||||||||||||||    
43985356 taaaatcacccaatcattttttttaacaagattcgtctatattcagtttaactcacccttttaaaagaggttgaacca 43985433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University