View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6002_high_10 (Length: 239)
Name: NF6002_high_10
Description: NF6002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6002_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 43985260 - 43985433
Alignment:
| Q |
18 |
gactactcaaagccccatccttctcgcatatcatagaccttcgaatactaaccctcttaaagtttagccatgcacacacaatacttaccaatatcttaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43985260 |
gactactcaaagccccatccttctcgcatatcatagaccttcgaatactaaccctcttaaagtttagccatg----cacaatacttaccaatatcttaaa |
43985355 |
T |
 |
| Q |
118 |
taaaatcactcaatca-nnnnnnnaataagattcgtctatattcagtttaactcacccttttaaaagaggttgaacca |
194 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985356 |
taaaatcacccaatcattttttttaacaagattcgtctatattcagtttaactcacccttttaaaagaggttgaacca |
43985433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University