View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6002_high_13 (Length: 225)
Name: NF6002_high_13
Description: NF6002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6002_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 211
Target Start/End: Original strand, 28086124 - 28086319
Alignment:
| Q |
16 |
cagtatgctccagtttcagccaatgtaatccaaacacaacaacccaaaatatgcatgcttatggtgctctgcttattgtaagtagaatacgacatggcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28086124 |
cagtatgctccagtttcagccaatgtaatccaaacacaacaacccaaaatatgcatgcttatggtgctctgcttattgtaagtagaatacgacatggcat |
28086223 |
T |
 |
| Q |
116 |
tggatgaaatcatgcttgctttggttctttttctctttagtttttcttcattctttaggcaatatggaaaacttccatccaactttaccttttcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28086224 |
tggatgaaatcatgcttgctttggttctttttctctttagtttttcttcattctttaggcaatatggaaaacttccatccaactttactttttcat |
28086319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 39 - 101
Target Start/End: Complemental strand, 41043951 - 41043889
Alignment:
| Q |
39 |
tgtaatccaaacacaacaacccaaaatatgcatgcttatggtgctctgcttattgtaagtaga |
101 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| || || || |||||||||||||| |
|
|
| T |
41043951 |
tgtaatccaaacacagcaacccaaaacatgcatgcttacggcgcattgattattgtaagtaga |
41043889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University