View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6002_high_14 (Length: 221)
Name: NF6002_high_14
Description: NF6002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6002_high_14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 2686470 - 2686257
Alignment:
| Q |
8 |
tcatcacaaatactattcacaaatcagacccttgaatcacccaaccaaacatttgttcttggtttcatccccggaacaaattccaacaacatttacttag |
107 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686470 |
tcatcacaaattctattgacaaatcagacccttgaatcacccaaccaaacatttgttcttggtttcatccccggaacaaattccaacaacatttacttag |
2686371 |
T |
 |
| Q |
108 |
ccatatggtacaaaaacatcgaagacacgattgtttgggtcgcaaacagagacaacccccttcaaacttcaaccaatagtcacctcaaactcggtgacaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
2686370 |
ccatatggtacaaaaacatcgaagacactgttgtttgggtcgcaaacagagacaaccctcttcaaaattcaaccaatagtcacctcaaaatcggtgacaa |
2686271 |
T |
 |
| Q |
208 |
tggaaacatagtac |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2686270 |
tggaaacatagtac |
2686257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University