View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6002_low_7 (Length: 275)
Name: NF6002_low_7
Description: NF6002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6002_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 11 - 147
Target Start/End: Original strand, 4929130 - 4929266
Alignment:
| Q |
11 |
cataggccatatatataaaatacctgatatacatattttgtctaattcaccaagataactataaccttaatgtagatgcaagtatattgcggggccaatc |
110 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4929130 |
catagtccatatatataaaataccttatatacatattttgtctaattcaccaagataactataaccttaatgtagatgcaagtatattgcggggccaatc |
4929229 |
T |
 |
| Q |
111 |
atcaagatttcaattttcttctcacctaaactaagac |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4929230 |
atcaagatttcaattttcttctcacctaaactaagac |
4929266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 189 - 261
Target Start/End: Original strand, 4929342 - 4929414
Alignment:
| Q |
189 |
ataacacatgtttccacaggcttcttccccatgtgagtgtaaatgtgacgtctaatttttagcatgttggaag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4929342 |
ataacacatgtttccacaggcttcttccccatgtgagtgtaaatgtgacgtctaatttttagcatgttggaag |
4929414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University