View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6003_high_12 (Length: 250)
Name: NF6003_high_12
Description: NF6003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6003_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 80 - 227
Target Start/End: Original strand, 33803812 - 33803959
Alignment:
| Q |
80 |
attaccattatattacattacatgaggggacatttgagattgtggataatatatggagttctttttggttgcaaaaactaatgtgcgaattttacttttn |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33803812 |
attaccattatattacattacatgaggggacatttgagattgtggataatatatgtagttctttttggttgcaaaaactaatgtgcgaattttactttta |
33803911 |
T |
|
| Q |
180 |
nnnnnnttgtcacaactaaaaatttacaaataacttcatatcatcttt |
227 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33803912 |
aaaaaattgtcacagctaaaaatttacaaataacttcatatcatcttt |
33803959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 58 - 146
Target Start/End: Original strand, 47491115 - 47491203
Alignment:
| Q |
58 |
ataatttgacatttcacatacaattaccattatattacattacatgaggggacatttgagattgtggataatatatggagttctttttg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47491115 |
ataatttgacatttcacatacaattaccattatattacattacatgaggggacatttgagattgtggataatatatggagttctttttg |
47491203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University