View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6003_low_6 (Length: 320)

Name: NF6003_low_6
Description: NF6003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6003_low_6
NF6003_low_6
[»] chr5 (1 HSPs)
chr5 (128-308)||(12818630-12818810)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 128 - 308
Target Start/End: Complemental strand, 12818810 - 12818630
Alignment:
128 atcacttcaaaaccctaatttattaaaaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttctccgaaa 227  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
12818810 atcacttcaaaaccctaatttattataaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttcttcgaaa 12818711  T
228 ccctaactttcaaaatttcaatgtctgattcaaattcaccacgtggtgaacaagaacaagaacaaaaagagaatcaaatga 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
12818710 ccctaactttcaaaatttcaatgtctgattcaaattcaccacgtggtgaacaagaacaagaacaagaagagaatcaaatga 12818630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University