View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6003_low_9 (Length: 283)
Name: NF6003_low_9
Description: NF6003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6003_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 54638661 - 54638407
Alignment:
| Q |
19 |
atctctggggctctacattaagataatataagcagaacgaggtgagacactagaatagtagaagagcaatcttaatctgtcccagaaaattgagcactaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54638661 |
atctctggggctctacattaagataatataagcagaacgaggtgagacactagaatagtagaagagcaatcttaatctgtcccagaaaattgagcactaa |
54638562 |
T |
 |
| Q |
119 |
agtcaattaacattacttggaagcttcgccagatttttgtgtctcatcccacaaacttccttgcactgctctagatagcttcatccaatgcaatggcttc |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54638561 |
agttaattaacattacttggaagcttcgccagatttttgtgtctcatcccacaaacttccttgcactgctctagatagcttcatccaatgcaatggcttc |
54638462 |
T |
 |
| Q |
219 |
aactttttggagtcattttttgagccaattgcacgtggtagaactcgtccctttg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54638461 |
aactttttggagtcattttttgagccaattgcacgtggtagaactcgtccctttg |
54638407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University