View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6006_low_22 (Length: 283)

Name: NF6006_low_22
Description: NF6006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6006_low_22
NF6006_low_22
[»] chr4 (2 HSPs)
chr4 (157-267)||(21289939-21290049)
chr4 (125-161)||(21290088-21290124)
[»] chr2 (1 HSPs)
chr2 (193-255)||(40776542-40776604)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 157 - 267
Target Start/End: Complemental strand, 21290049 - 21289939
Alignment:
157 aataattaaacgataaattcaaagaatttcgatattgttactaacccgaatatctctagaaagaggatgagaacaaagaacaccagtacaagtccgatcg 256  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21290049 aataattaaacgacaaattcaaagaatttcgatattgttactaacccgaatatctctagaaagaggatgagaacaaagaacaccagtacaagtccgatcg 21289950  T
257 gaaatcttcat 267  Q
    |||||||||||    
21289949 gaaatcttcat 21289939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 125 - 161
Target Start/End: Complemental strand, 21290124 - 21290088
Alignment:
125 accattaacttcagatttaaacaacatgctcaaataa 161  Q
    |||||||||||||||||||||||||||||||||||||    
21290124 accattaacttcagatttaaacaacatgctcaaataa 21290088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 193 - 255
Target Start/End: Original strand, 40776542 - 40776604
Alignment:
193 gttactaacccgaatatctctagaaagaggatgagaacaaagaacaccagtacaagtccgatc 255  Q
    ||||| |||||||||||| | |||||||||||||||||| ||||||||||| || ||||||||    
40776542 gttaccaacccgaatatcccgagaaagaggatgagaacatagaacaccagtgcatgtccgatc 40776604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University