View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6007_high_1 (Length: 365)
Name: NF6007_high_1
Description: NF6007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6007_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 351
Target Start/End: Complemental strand, 9967298 - 9966963
Alignment:
| Q |
11 |
cataggtatatgtttgttctttagggcatgcccatgcgacctttcaggtattggttgtacgttttgtccccgaccattgttatgtttttgtcgtactctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9967298 |
cataggtatatgtttgttctttagggcatgcccatgcgacctttcaggtattggttgtacgttttgtccccgaccattgttatgtttttgtcgtactctt |
9967199 |
T |
 |
| Q |
111 |
ataggcattcattgctagtgtcataatttgttgagcatcgtttatttcgtataaattgagtatctatgtttacacatgcaagccctcnnnnnnnnnnnnn |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9967198 |
ataggcattcattgctagtgtcataatttgttgagcatcgtttatttggtataagttgagtatctatgtttacacatgcaagccct----aaaaaaaaaa |
9967103 |
T |
 |
| Q |
211 |
nnnngtgtacacatgcaagattaatttctcaagagctttgattaacaaagctctttgcactctttagattatgcattatcttgtccaaggcattgttttt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9967102 |
aaaagtgtacacatgcaagattaatttctcaagagctttgattaacaaagctctttgcactctttagattatgcattatcttgtccaaggcatttttttt |
9967003 |
T |
 |
| Q |
311 |
atttttcttaatttatatatctcttatctatatgattaatt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9967002 |
atttttcttaatttatatatctcttatc-atatgattaatt |
9966963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University