View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6008_low_11 (Length: 243)
Name: NF6008_low_11
Description: NF6008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6008_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 47774187 - 47774388
Alignment:
| Q |
1 |
cttataaatagcctcctaattaagtgctccaacaaacatggaatgaatgacatccaagttaaacagcagtggtgttcaatctaattggttgacannnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47774187 |
cttataaatagcctcctaattaagtgctccaacaaacatggaatgaatgacatccaagttaaacagcagtggtgttcaatctaattggttgacatttttt |
47774286 |
T |
 |
| Q |
101 |
nataactttgtttgattggtcatcttttgcggcctgcatatgtaa--nnnnnnncttctaacaataaacctgatcgaaattcagctacttggtaagaaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47774287 |
tataactttgtttgattggtcatcttttgcggcctgcatatgtaattttttttttttctaacaataagcctgatcgaaattcagctacttggtaagaaat |
47774386 |
T |
 |
| Q |
199 |
at |
200 |
Q |
| |
|
|| |
|
|
| T |
47774387 |
at |
47774388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University