View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6008_low_12 (Length: 234)
Name: NF6008_low_12
Description: NF6008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6008_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 97 - 214
Target Start/End: Original strand, 9172070 - 9172187
Alignment:
| Q |
97 |
cgtctatgaaagctgtgatgcaaatgatgcaaagagatggagacaacttaaaagttccctgcaacccttttggacctacaacttcatctaatacaactac |
196 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||||||||||| ||| ||||||| | ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9172070 |
cgtctatgaaaactgtgatgcaaatgctgcaaggagatggagacaagttacaagttccttcaaacccttatggacctacaacttcatctaatacaactac |
9172169 |
T |
|
| Q |
197 |
tagtattgttgcaccacc |
214 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
9172170 |
taatattgttgcaccacc |
9172187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 98 - 170
Target Start/End: Complemental strand, 9257054 - 9256982
Alignment:
| Q |
98 |
gtctatgaaagctgtgatgcaaatgatgcaaagagatggagacaacttaaaagttccctgcaacccttttgga |
170 |
Q |
| |
|
||||||||||| ||||||||||||| || || ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9257054 |
gtctatgaaagatgtgatgcaaatgctgaaaggagatggagacaacttaaaagtttcctgcaacccttttgga |
9256982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 102 - 206
Target Start/End: Complemental strand, 9466269 - 9466165
Alignment:
| Q |
102 |
atgaaagctgtgatgcaaatgatgcaaagagatggagacaacttaaaagttccctgcaacccttttggacctacaacttcatctaatacaactactagta |
201 |
Q |
| |
|
|||||| ||||||| |||||| | ||| | ||||||||||| |||||||| ||| |||| |||||||| |||||||||||| ||||| ||||| |||||| |
|
|
| T |
9466269 |
atgaaaactgtgatacaaatgctacaaggtgatggagacaagttaaaagtccccagcaatccttttgggcctacaacttcaactaattcaactgctagta |
9466170 |
T |
|
| Q |
202 |
ttgtt |
206 |
Q |
| |
|
|||| |
|
|
| T |
9466169 |
ctgtt |
9466165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 209
Target Start/End: Original strand, 9238409 - 9238474
Alignment:
| Q |
144 |
ttaaaagttccctgcaacccttttggacctacaacttcatctaatacaactactagtattgttgca |
209 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| ||||| | |||| |||||||| || ||||||| |
|
|
| T |
9238409 |
ttaaaagttccctccaacccttttggatctacagcttcagcaaataaaactactattaatgttgca |
9238474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University