View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_high_24 (Length: 279)
Name: NF6009_high_24
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 279
Target Start/End: Complemental strand, 51521853 - 51521594
Alignment:
| Q |
19 |
ggaggaatcttaatagagagaacgaacgatcaggaatttaattttttatgtgttgggtttgacgggggagaggaaaagtttaatggaggtaaattgcaaa |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
51521853 |
ggaggaatcttaatagagagaacaaacgatgaggaatttaattttttatgtgttgggtttgacgagggagaggaaaaatttaatggaggtaaattgcaaa |
51521754 |
T |
 |
| Q |
119 |
attatannnnnnnncacaatagtgatgttcaagatttgacatcaaataaaaataatgaatgtttaagatgtgaaaattgcatatcaaattcacttaacta |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51521753 |
attatatattttttcacaatagtgatgttcaagatgtgacatcaaataaaa-taatgaatgtttaagatgtgaaaattgcatatcaaattcacttaacta |
51521655 |
T |
 |
| Q |
219 |
tatcaaatcatagattgaattaactaacaaccaccgacatagttaagtgaatttgatatgc |
279 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51521654 |
tatcaaatcatagattgaattaattaacaaccaccgacatagttaagtgaatttgatatgc |
51521594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University