View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_high_30 (Length: 246)
Name: NF6009_high_30
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 56316370 - 56316172
Alignment:
| Q |
25 |
caacccccaaagaataaatatgagatgacatattgttcaagtagatattgaccgtaaatatacctccattgtcagcaaaactactacactaatcttcatt |
124 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56316370 |
caacccccaaagaagaaatatgagatgacatattgttcaagtagatattgacagtaaatatatctccattgtcagcaaaactactacactaatcttcatt |
56316271 |
T |
|
| Q |
125 |
gttgttcaaagtggtcgattggataagagtcagaagtttcaagtacaaagcttcctcccatataaagaagggtctacgccaccacactttaaacaccac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56316270 |
gttgttcaaagtggtcgattggataagagtcagaagtttcaagtacaaagcttcctcccatataaagaagggtctacgccaccaaactttaaacaccac |
56316172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University