View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_high_32 (Length: 243)
Name: NF6009_high_32
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 7 - 140
Target Start/End: Original strand, 26520915 - 26521048
Alignment:
| Q |
7 |
aggagcagcacagaggtcgaggacagcgcatgaggattcgaggaaatggaactttgaattgagttgaatgagtttccatgatgctctacagcggtaaccg |
106 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26520915 |
aggagcagcgcagaggttgaggacagcgcatgaggattcgaggaaatggaactttgaattgagttgaatgagtttccatgatgctctacagcggtaaccg |
26521014 |
T |
|
| Q |
107 |
tgttctttggctaagaagtagaatttgtctaaac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
26521015 |
tgttctttggctaagaagtagaatttgtgtaaac |
26521048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 140
Target Start/End: Original strand, 30378375 - 30378508
Alignment:
| Q |
7 |
aggagcagcacagaggtcgaggacagcgcatgaggattcgaggaaatggaactttgaattgagttgaatgagtttccatgatgctctacagcggtaaccg |
106 |
Q |
| |
|
|||||| || ||||| ||||| || | || ||||||||||||||||||||| || ||||||| ||||| ||||||||||||||| | | | | ||||||| |
|
|
| T |
30378375 |
aggagcggcgcagagatcgagaacggagcgtgaggattcgaggaaatggaatttggaattgatttgaacgagtttccatgatgcacgagaacagtaaccg |
30378474 |
T |
|
| Q |
107 |
tgttctttggctaagaagtagaatttgtctaaac |
140 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| |
|
|
| T |
30378475 |
tgttctttggctaagtagtagtatttgtctaaac |
30378508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University