View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6009_high_33 (Length: 238)

Name: NF6009_high_33
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6009_high_33
NF6009_high_33
[»] chr1 (1 HSPs)
chr1 (153-220)||(26520590-26520657)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 153 - 220
Target Start/End: Original strand, 26520590 - 26520657
Alignment:
153 attgaatgggagaatgtaatgatgaatgttgtttgctatagtttttcctagtgttactcctatactat 220  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
26520590 attgaatgggagaatgtaatgatgaatgttgtttggtatagtttttcctagtgttactcctatactat 26520657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University