View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_high_33 (Length: 238)
Name: NF6009_high_33
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 153 - 220
Target Start/End: Original strand, 26520590 - 26520657
Alignment:
| Q |
153 |
attgaatgggagaatgtaatgatgaatgttgtttgctatagtttttcctagtgttactcctatactat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26520590 |
attgaatgggagaatgtaatgatgaatgttgtttggtatagtttttcctagtgttactcctatactat |
26520657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University