View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_high_34 (Length: 237)
Name: NF6009_high_34
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 173
Target Start/End: Complemental strand, 53275644 - 53275483
Alignment:
| Q |
12 |
agtagcaaaggtagagaagatgattcaattcaattataattgtgctattgtttgttaatggtactttttctttgttgtcggttgttaactactacttaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53275644 |
agtagcaaaggtagagaagatgattcaattcaattataattgtgctattgtttgttaatggtactttttctttgttgtcggttgttaactaatacttaat |
53275545 |
T |
|
| Q |
112 |
tgttagatttgatgaaaatttatagttatttatttggtcttccccagaaaacaaaaccatat |
173 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53275544 |
tgttagatttgatgaaaatttatggttatttatttggtcttgcccagaaaacaaaaccatat |
53275483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 12 - 170
Target Start/End: Original strand, 34451108 - 34451272
Alignment:
| Q |
12 |
agtagcaaaggtagagaagatgattcaattcaattataattgtgctattgtttgtta------atgg-tactttttctttgttgtcggttgttaactact |
104 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | |
|
|
| T |
34451108 |
agtagcaaaggtagagaagaggattcaattcaattataattgtgctattgtttgttattgttaatggctactttttctttgttgtcggttgttaactgcc |
34451207 |
T |
|
| Q |
105 |
acttaattgttagatttgatgaaaatttatagttatttatttggtcttccccagaaaacaaaacca |
170 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| || ||| |||| ||||||||||||||||| |
|
|
| T |
34451208 |
acttaattgttagatttgatgaaaattcatggttatata-ttgatcttgcccagaaaacaaaacca |
34451272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 53273077 - 53273035
Alignment:
| Q |
175 |
gtatgtactatcgcattttctcaaattggagaagctgtatatc |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53273077 |
gtatgtaccatcgcattttctcaaattggagaagctgtatatc |
53273035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 107 - 170
Target Start/End: Original strand, 39937464 - 39937527
Alignment:
| Q |
107 |
ttaattgttagatttgatgaaaatttatagttatttatttggtcttccccagaaaacaaaacca |
170 |
Q |
| |
|
||||||| | |||| |||||||||| || | |||||||||||||| ||||||||||||||||| |
|
|
| T |
39937464 |
ttaattgattgattcgatgaaaattaatggatatttatttggtctcacccagaaaacaaaacca |
39937527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University