View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_low_14 (Length: 366)
Name: NF6009_low_14
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 18 - 356
Target Start/End: Original strand, 17301501 - 17301839
Alignment:
| Q |
18 |
tggttatgggttattttgttgatactggctcaaccacttctattttctctatttttgttgatatgagtgtctatcgtgtcaaacctaatgctacgacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17301501 |
tggttatgggttattttgttgatactggctcaaccacttctattttctctatttttgttgatatgagtgtctatcgtgtcaaacctaatgctacgacttt |
17301600 |
T |
 |
| Q |
118 |
taataaagctttccttggttttcttgaggagaacaaatttgaggagattgaaaagttggtttatttgatggaatataggtatgggttaactccatatccc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17301601 |
taataaagctttccttggttttcttgaggagaacaaatttgaggagattgaaaagttggtttatttgatggaaaataggtatgggttaactccatatcct |
17301700 |
T |
 |
| Q |
218 |
atgagttatagtgttaggttaaagggtttatgtaagttgaagatgtttgatgaggctaggagggtaattgggctgaaggcacagacagggttaaaaccgt |
317 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17301701 |
atgagttatagtgttaggataaagggtttatgtaagttgaagatgtttgatgaggctaggagggtaattgggctgaaggcacagacagggttaaaaccgt |
17301800 |
T |
 |
| Q |
318 |
ctgtcaatgatttttatcatttaatttctggggtctgtg |
356 |
Q |
| |
|
||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
17301801 |
ctgtcgaagatttttatcctttaatttctggggtctgtg |
17301839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University