View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_low_18 (Length: 325)
Name: NF6009_low_18
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 41 - 313
Target Start/End: Complemental strand, 54719168 - 54718893
Alignment:
| Q |
41 |
gaaattcccattcctctccaaagtcagatccaaattaacaacaacaacaa---tcacaacgacacattcaaccatcacgacgattttctcaaacaaatcc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54719168 |
gaaattcccattcctctccaaagtcagatccaaattaacaacaacaacaacaatcacaacgacacattcaaccatcacgacgattttctcaaacaaatcc |
54719069 |
T |
|
| Q |
138 |
tctccaccaatcttcctccttcatggaacactctcgaccctaaccataacaaacccttattatgggaccccaattccgacgaaaatgttactttccctaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54719068 |
tctccaccaatcttcctccttcatggaacactctcgacccaaaccataacaaacccttattatgggaccccaattccgacgaaaatgtcactttccctaa |
54718969 |
T |
|
| Q |
238 |
ttacgatgaacaacacaacaaccttgcctctaagtttcgtaaccaccagatcactgacaaaaccgccgccgctctc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54718968 |
ttacgatgaacaacacaacaaccttgcctctaagtttcgtaaccaccagatcactgacaaaaccgccgccgctctc |
54718893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University