View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_low_22 (Length: 290)
Name: NF6009_low_22
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 27 - 274
Target Start/End: Complemental strand, 42037072 - 42036825
Alignment:
| Q |
27 |
cactccactcccgttggtcatggcttaggagaatcacttcttaaacgacaagcaagaatcaatgatgcatgttccttactcattcaatttggtttccatc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42037072 |
cactccactcccgttggtcatggcttaggagaatcacttcttaaacgacaagcaagaatcaatgatgcatgttccttactcattcaattcggtttccatc |
42036973 |
T |
 |
| Q |
127 |
aagggatttttaccatcaacaatcttcttagccaaggctacaccgacgatgactttctggagcttatcgagccaattacttccataacagatttggagga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42036972 |
aagggatttttaccatcaacaatcttcttagccaaggctacaccgacgatgactttctggagcttatcaagccaattacttccataacagatttggagga |
42036873 |
T |
 |
| Q |
227 |
attaagatatctttacaacataacttgtcaatataaccattttccaca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42036872 |
attaagatatctttacaacataacttgtaaatataaccattttccaca |
42036825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University