View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_low_31 (Length: 245)
Name: NF6009_low_31
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 43816565 - 43816351
Alignment:
| Q |
18 |
acactcccctcaggaagaattgttgttgttaaacgtttgttttttgatacaaggcaatggacagatgtgttattcagtgaagtcaatttgattaatggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43816565 |
acactcccctcaggaagaattgttgttgttaaacgtttgttttttgatacaaggcaatggacagatgtgttattcagtgaagtcaatttgattaatggga |
43816466 |
T |
|
| Q |
118 |
ttcaacataagaatgtggtcaaacttttggggtgtagtattgatggccctgaaagcttgttggtttatgaatttcttcctaataaaagtcttgatcaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43816465 |
ttcaacataagaatgtggtcaaacttttggggtgtagtattgatggccctgaaagcttgttggtttatgaatttcttcctaataaaagtctagatcaaat |
43816366 |
T |
|
| Q |
218 |
cctttccggtgagta |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43816365 |
cctttccggtgagta |
43816351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University