View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_low_36 (Length: 236)
Name: NF6009_low_36
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 37485494 - 37485289
Alignment:
| Q |
16 |
atatgctagatagtccaaacaagttagacataaaatggaaatactaagtagattgcaaaagacacaatagccatgtcaagcattagggagtaccagatag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37485494 |
atatgctagatagtccaaacaagttagacataaaatggaaatactaagtagattgcaaaagacacaataaccatgtcaagcattagggagtaccagatag |
37485395 |
T |
|
| Q |
116 |
aaaacatgcatgtagtgatctgaaaaggacgatcaacttattaattaattaataatagcttaattttcttcaatgaccaattcctcaatcatattattgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37485394 |
aaaacatgcatgtagtgatctgaaaaggacgatcaacttattaattaattaataatagcttaattttcttcaatgaccaattcctcaatcatattattgc |
37485295 |
T |
|
| Q |
216 |
catggt |
221 |
Q |
| |
|
|||||| |
|
|
| T |
37485294 |
catggt |
37485289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University