View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6009_low_38 (Length: 202)
Name: NF6009_low_38
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6009_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 81 - 187
Target Start/End: Complemental strand, 4279801 - 4279694
Alignment:
| Q |
81 |
ttaattgatatatacc-acaactgaatggaatcattgaaataattcaacatgatttaacaaatggattattatattaataaattgcgttcaattatttta |
179 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4279801 |
ttaattgatatataccgacgattgaatggaatcattgaaataattcaacatgatttaacaaatagattattatattgatacattgcgttcaattatttta |
4279702 |
T |
 |
| Q |
180 |
atgattct |
187 |
Q |
| |
|
|||||||| |
|
|
| T |
4279701 |
atgattct |
4279694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 14 - 82
Target Start/End: Complemental strand, 1810426 - 1810358
Alignment:
| Q |
14 |
ataatactgactcggtgtggagaggaaaatgaagactggaatcaggagaagaagcgatagatcgaagtt |
82 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
1810426 |
ataatacagactcgatgtggagaggaaaatgaagactggaatcgggagaagaagcgatggatcgaagtt |
1810358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University