View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6009_low_38 (Length: 202)

Name: NF6009_low_38
Description: NF6009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6009_low_38
NF6009_low_38
[»] chr8 (1 HSPs)
chr8 (81-187)||(4279694-4279801)
[»] chr2 (1 HSPs)
chr2 (14-82)||(1810358-1810426)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 81 - 187
Target Start/End: Complemental strand, 4279801 - 4279694
Alignment:
81 ttaattgatatatacc-acaactgaatggaatcattgaaataattcaacatgatttaacaaatggattattatattaataaattgcgttcaattatttta 179  Q
    |||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||    
4279801 ttaattgatatataccgacgattgaatggaatcattgaaataattcaacatgatttaacaaatagattattatattgatacattgcgttcaattatttta 4279702  T
180 atgattct 187  Q
    ||||||||    
4279701 atgattct 4279694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 14 - 82
Target Start/End: Complemental strand, 1810426 - 1810358
Alignment:
14 ataatactgactcggtgtggagaggaaaatgaagactggaatcaggagaagaagcgatagatcgaagtt 82  Q
    ||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||    
1810426 ataatacagactcgatgtggagaggaaaatgaagactggaatcgggagaagaagcgatggatcgaagtt 1810358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University