View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6011_high_11 (Length: 251)
Name: NF6011_high_11
Description: NF6011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6011_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 67 - 242
Target Start/End: Original strand, 44203066 - 44203241
Alignment:
| Q |
67 |
tgaaaattgtttatctatatttcgttcctatagaaataataataattatatgatcatcggtttgattgataaaaaagaattgatcaatacttatttggtt |
166 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44203066 |
tgaaaagtgtttatctatatttcgttactatagaaataataataattatatgatcatcggtttgattgataaaaaagaattgatcaatacttatttggtt |
44203165 |
T |
|
| Q |
167 |
tnnnnnnngcacttattcaataaaggcttaatcacatttctatccaccatacatgcacccttagcaggagtattat |
242 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44203166 |
taaaaaaagcacttattcaataaaggcttaatcaaatttctatccaccatacatgcacacttagcaggagtattat |
44203241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University