View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6011_high_13 (Length: 239)

Name: NF6011_high_13
Description: NF6011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6011_high_13
NF6011_high_13
[»] chr2 (1 HSPs)
chr2 (47-222)||(12439311-12439491)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 12439491 - 12439311
Alignment:
47 cttcaacaaatctgaaaaacaaagaggnnnnnnnngggctaaataaatagcaaacaagaggatgaaggttcattcaacagattgaagattttggggtttt 146  Q
    |||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12439491 cttcaacaaatctgaaaaacaaagaggaaaaaaa-gggctaaataaatagcaaacaagaggatgaaggttcattcaacagattgaagattttggggtttt 12439393  T
147 gttcttc------aactgaattaatttagcaaagataatgaaatcattgtcttacaattctattagatgtatgataggaaag 222  Q
    |||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12439392 gttcttcaacttcaactgaattaatttagcaaagataatgaaatcattgtcttacaattctattagatgtatgataggaaag 12439311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University