View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6011_high_5 (Length: 278)
Name: NF6011_high_5
Description: NF6011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6011_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 124 - 266
Target Start/End: Original strand, 44202627 - 44202769
Alignment:
| Q |
124 |
aagtcattcaaaagtatttaaatgcatggcgggctataattaaaaacttgggaatgagtaattttggaagacatggttcaattaaacgagctctaaattc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44202627 |
aagtcattcaaaagtatttaaatgcatggcgggctataattaaaaacttgggaatgagtaattttggaagacatggttcaattaaacgagctctaaattc |
44202726 |
T |
|
| Q |
224 |
cttgaccacttttattcttatgagatgataaattttgactata |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44202727 |
cttgaccacttttattcttatgagatgataaattttgactata |
44202769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 44202521 - 44202558
Alignment:
| Q |
18 |
acttcatggtcttctctttgtctatcgtaccaacatgt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44202521 |
acttcatggtcttctctttgtctatcgtactaacatgt |
44202558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University