View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6011_low_13 (Length: 239)
Name: NF6011_low_13
Description: NF6011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6011_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 12439491 - 12439311
Alignment:
| Q |
47 |
cttcaacaaatctgaaaaacaaagaggnnnnnnnngggctaaataaatagcaaacaagaggatgaaggttcattcaacagattgaagattttggggtttt |
146 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12439491 |
cttcaacaaatctgaaaaacaaagaggaaaaaaa-gggctaaataaatagcaaacaagaggatgaaggttcattcaacagattgaagattttggggtttt |
12439393 |
T |
|
| Q |
147 |
gttcttc------aactgaattaatttagcaaagataatgaaatcattgtcttacaattctattagatgtatgataggaaag |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12439392 |
gttcttcaacttcaactgaattaatttagcaaagataatgaaatcattgtcttacaattctattagatgtatgataggaaag |
12439311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University