View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6011_low_4 (Length: 310)
Name: NF6011_low_4
Description: NF6011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6011_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 85 - 291
Target Start/End: Complemental strand, 11369285 - 11369078
Alignment:
| Q |
85 |
taccctaaaggtaggtttaaagaataacattttt-aagacaaaatgatatcaaacatgattaattaaataatccaaaataactaagtcaaacttattata |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369285 |
taccctaaaggtaggtttaaagaataacatttttgaagacaaaatgatatcaaacatgattaattaaataatccaaaataactaagtcaaacttattata |
11369186 |
T |
|
| Q |
184 |
tccagtgatataatgcctgcctagtaagtcaatcattcatcaaataagatagatagctcaagaacatgtgaatacgactatctaattttgttatctagtg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369185 |
tccagtgatataatgcctgcctagtaagtcaatcattcatcaaataagatagatagctcaagaacatgtgaatacgactatctaattttgttatctagtg |
11369086 |
T |
|
| Q |
284 |
gttagaaa |
291 |
Q |
| |
|
|||||||| |
|
|
| T |
11369085 |
gttagaaa |
11369078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 243 - 287
Target Start/End: Complemental strand, 11369061 - 11369017
Alignment:
| Q |
243 |
aagaacatgtgaatacgactatctaattttgttatctagtggtta |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11369061 |
aagaacatgtgaatacgactatctaattttgttatccagtggtta |
11369017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 45
Target Start/End: Complemental strand, 11369355 - 11369323
Alignment:
| Q |
13 |
attcttcaaatcaatgtaaacaactcctgcaaa |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11369355 |
attcttcaaatcaatgtaaacaactcctgcaaa |
11369323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University