View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6011_low_8 (Length: 263)
Name: NF6011_low_8
Description: NF6011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6011_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 29 - 247
Target Start/End: Original strand, 48857335 - 48857553
Alignment:
| Q |
29 |
taaaaataagcatggacagcttctatgaaggtttgatctaatgatcactacaaaaagnnnnnnnnnnnnnnnnnnatgaaggtttgatataatcaccaca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
48857335 |
taaaaataagcatggacagcttctatgaaggtttgatctaatgatcactgcaaaaagtttttatttttattttttatgaaggtttgatataatcaccaca |
48857434 |
T |
 |
| Q |
129 |
aagattttaaaatcaaatgataagttttccaaccttgattctaaaagaactatgaataacctannnnnnnctttacacccaatctgggatccctcgccct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48857435 |
aagattttaaaatcaaatgataagttttccaaccttgattctaaaagaactatgaataacctatttttttctttacacccaatctgggatccctcgccct |
48857534 |
T |
 |
| Q |
229 |
caacaacacctgaattaag |
247 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48857535 |
caacaacacctgaattaag |
48857553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University