View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6013_high_5 (Length: 485)
Name: NF6013_high_5
Description: NF6013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6013_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 397; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 13 - 471
Target Start/End: Complemental strand, 36113228 - 36112785
Alignment:
| Q |
13 |
tgaataacggaattatctcattttctctctctagctctcgggttaaggtttagattctctgatggcttcttcttcctccgatccaggcaagtctgcggag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36113228 |
tgaataacggaattatctcattttctctctctagctctcgggttaaggtttagattctctgatggcttcgtcttcctccgatccaggcaagtctgcggag |
36113129 |
T |
|
| Q |
113 |
acatcagaagcagtggcggcggcgaatgatcagcttttactatacagaggattgaagaaagcgaagaaagagagaggttgtactgctaaagaacgaatca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36113128 |
acatcagaagcagtggcggcggcgaatgatcagcttttactgtacagaggattgaagaaagcgaagaaagagagaggttgtactgctaaagaacgaatca |
36113029 |
T |
|
| Q |
213 |
gtaaaatgcctccgtgtgctgccggtaaacgcagctccatctaccgcggtgttaccaggtagcttgcaacttgaagagtgcttattagatttaggttcat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36113028 |
gtaaaatgcctccgtgtgctgccggtaaacgcagctccatctaccgcggtgttaccaggtagcttgcaacttgaagagtgcttattagatttaggttcat |
36112929 |
T |
|
| Q |
313 |
tttggatcactttaaagtttcggttaattaacttatgatctgtttgggaagcacaataagttagcttataagatcatatgattaataattactattttgt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36112928 |
tttggatcactttaaagtttcggttaattaacttatgatctgtttgggaagcacaatcagttagcttataagatcatatgattaataatt---------- |
36112839 |
T |
|
| Q |
413 |
taaccgtccctttctcacaagtttactagtttgtgccattttttgaagctagttcaagt |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36112838 |
-----gtccctttctcacaagtttactagtttgtgccattttttgaagctagttcaagt |
36112785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 391
Target Start/End: Complemental strand, 28175809 - 28175769
Alignment:
| Q |
351 |
tctgtttgggaagcacaataagttagcttataagatcatat |
391 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28175809 |
tctgtttggcaagcacaataagttagcttataagctcatat |
28175769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University