View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6013_low_10 (Length: 271)
Name: NF6013_low_10
Description: NF6013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6013_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 4080820 - 4081035
Alignment:
| Q |
1 |
agttgactcttttgtatccctttgttagtttatagtttt-tatgcaatacttagatgtacatgtggtatgccttttaattatctaggtgagaagcattcc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4080820 |
agttgactcttttgtatccctttgttagtttatagttttttatgcaatacttagatgtacatgtggtatgccttttaattatctaggtgagaagcattcc |
4080919 |
T |
 |
| Q |
100 |
ttggcctgatatgagtttattaatatgtttttgttgttcttagggaagccaatcttctgcatgtccttataatttgttttttacttttatatattcgaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4080920 |
ttggcctgatatgagtttattaatatgcttttgttgtccttagggaagccaatcttctgcatgtccttataatttgttttttgcttttatatattcgaga |
4081019 |
T |
 |
| Q |
200 |
ttggatatggacaatg |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4081020 |
ttggatatggacaatg |
4081035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 4845735 - 4845684
Alignment:
| Q |
11 |
tttgtatcccttt-gttagtttatagtttttatgcaatacttagatgtacat |
61 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4845735 |
tttgtatcccttttgttagtttatagtttttatgcaatatttagatgtacat |
4845684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University