View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6015_high_23 (Length: 239)
Name: NF6015_high_23
Description: NF6015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6015_high_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 49813545 - 49813327
Alignment:
| Q |
17 |
agtttgttggagaaagagctctttgaggaacattcttgcgtttacaagttttgccatgcatggtttcatggagtttgtggcaaagaaggtatttgaagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49813545 |
agtttgttggagaaagagctctttgaggaacattcttgcgtttacaagttttgccatg----gtttcatggagtttgtggcaaagaaggtatttgaagct |
49813450 |
T |
 |
| Q |
117 |
ttgagaagatgtaactgcgtcagctgatcaagtaattatcgagcatataatttcttcaattttttgaaacatgctaaacatcaatatctcaatgacaatc |
216 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49813449 |
ttgagaagacgtaactgagtcagctgatcaagtaattattgagcatataatttcttcaattttttgaaacatgctaaacatcaatatctcaatgacaatc |
49813350 |
T |
 |
| Q |
217 |
tccctgcacactcactggttttt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49813349 |
tccctgcacactcactggttttt |
49813327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University